|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927667 |
1145927680 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659712-28659734
|
17:28659753-28659775
|
| Sequence |
CCAGACGGGGTGGCGGCCGGGCA |
CAGACGGGGCGGCCAGGCAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1163, 1: 2416, 2: 2885, 3: 2217, 4: 1432} |
{0: 70, 1: 691, 2: 2920, 3: 4801, 4: 1961} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|