|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927669 |
1145927677 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659728-28659750
|
17:28659747-28659769
|
| Sequence |
CCGGGCAGAGGCCCTCCTCATAT |
ATATCCCAGACGGGGCGGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 8, 2: 1074, 3: 3522, 4: 14587} |
{0: 2, 1: 75, 2: 1068, 3: 2815, 4: 5171} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|