ID: 1145927669_1145927680

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1145927669 1145927680
Species Human (GRCh38) Human (GRCh38)
Location 17:28659728-28659750 17:28659753-28659775
Sequence CCGGGCAGAGGCCCTCCTCATAT CAGACGGGGCGGCCAGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 1074, 3: 3522, 4: 14587} {0: 70, 1: 691, 2: 2920, 3: 4801, 4: 1961}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!