ID: 1145927669_1145927682

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1145927669 1145927682
Species Human (GRCh38) Human (GRCh38)
Location 17:28659728-28659750 17:28659777-28659799
Sequence CCGGGCAGAGGCCCTCCTCATAT GCTCCTCACATCCCAGACGATGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 1074, 3: 3522, 4: 14587} {0: 1126, 1: 1000, 2: 1572, 3: 687, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!