|
Left Crispr |
Right Crispr |
Crispr ID |
1145927678 |
1145927682 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:28659751-28659773
|
17:28659777-28659799
|
Sequence |
CCCAGACGGGGCGGCCAGGCAGA |
GCTCCTCACATCCCAGACGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 75, 1: 721, 2: 1943, 3: 4778, 4: 1872} |
{0: 1126, 1: 1000, 2: 1572, 3: 687, 4: 367} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|