ID: 1145959468_1145959475

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1145959468 1145959475
Species Human (GRCh38) Human (GRCh38)
Location 17:28879100-28879122 17:28879117-28879139
Sequence CCCTCCACCTTCTGCCTGTGATG GTGATGGAGCCAGGTGTTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!