ID: 1146090691_1146090695

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1146090691 1146090695
Species Human (GRCh38) Human (GRCh38)
Location 17:29874401-29874423 17:29874426-29874448
Sequence CCACCCAGATCTCATCTTGAATT ACTCCCTATAACCCCGATAAGGG
Strand - +
Off-target summary {0: 204, 1: 7933, 2: 11320, 3: 9617, 4: 8545} {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!