ID: 1146180634_1146180645

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1146180634 1146180645
Species Human (GRCh38) Human (GRCh38)
Location 17:30696088-30696110 17:30696137-30696159
Sequence CCAGTGGCTCCCATCTGATGGTG TCACAACTGGGGGGTGCTGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 26, 4: 169} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!