ID: 1146180636_1146180640

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1146180636 1146180640
Species Human (GRCh38) Human (GRCh38)
Location 17:30696098-30696120 17:30696124-30696146
Sequence CCATCTGATGGTGATTATGCCCC CAACAGACATTTGTCACAACTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 74} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!