ID: 1146184689_1146184696

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1146184689 1146184696
Species Human (GRCh38) Human (GRCh38)
Location 17:30717219-30717241 17:30717242-30717264
Sequence CCAGGAGGCCAGAAGGGAGGCCA GGAGGCAACCAGCAAGGTGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 71, 4: 442} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!