ID: 1146295209_1146295211

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1146295209 1146295211
Species Human (GRCh38) Human (GRCh38)
Location 17:31644493-31644515 17:31644515-31644537
Sequence CCTATAACTGCAGCACTTTGGGA AGGCTAAGTCCTGTGCAACGTGG
Strand - +
Off-target summary {0: 6, 1: 123, 2: 3196, 3: 52194, 4: 358194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!