ID: 1146445310_1146445316

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1146445310 1146445316
Species Human (GRCh38) Human (GRCh38)
Location 17:32928158-32928180 17:32928175-32928197
Sequence CCGCTGCAGGCCCGCGCCCGCGC CCGCGCCCGGACTTTGCCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 310} {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!