ID: 1146633234_1146633238

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1146633234 1146633238
Species Human (GRCh38) Human (GRCh38)
Location 17:34485352-34485374 17:34485367-34485389
Sequence CCCTGTCAGCCTGCTGGGGCTTT GGGGCTTTGCAGACGCAGACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!