ID: 1146827908_1146827910

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1146827908 1146827910
Species Human (GRCh38) Human (GRCh38)
Location 17:36039919-36039941 17:36039936-36039958
Sequence CCAACGTGTTCGAACTGCAGGTG CAGGTGTGAGCCACTGCTCTGGG
Strand - +
Off-target summary No data {0: 36, 1: 1057, 2: 13913, 3: 52077, 4: 118052}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!