ID: 1146877793_1146877802

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1146877793 1146877802
Species Human (GRCh38) Human (GRCh38)
Location 17:36426936-36426958 17:36426974-36426996
Sequence CCGGGGCTCCTGTGTGCATCTGT GCACAGGCGTGGAACGGAAGAGG
Strand - +
Off-target summary {0: 11, 1: 2, 2: 4, 3: 39, 4: 377} {0: 10, 1: 2, 2: 1, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!