ID: 1146906168_1146906175

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1146906168 1146906175
Species Human (GRCh38) Human (GRCh38)
Location 17:36619388-36619410 17:36619422-36619444
Sequence CCAGGTGCAGTGGCTCATGCCTG CTTTGGAAGGCCAAGGTGGATGG
Strand - +
Off-target summary {0: 6440, 1: 26478, 2: 70922, 3: 127775, 4: 147131} {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!