ID: 1146948486_1146948492

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1146948486 1146948492
Species Human (GRCh38) Human (GRCh38)
Location 17:36890153-36890175 17:36890199-36890221
Sequence CCCAGAGCAAGGCCTTATCAGAG CTCCCCATCAAATAGGAAAACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!