ID: 1146948487_1146948493

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1146948487 1146948493
Species Human (GRCh38) Human (GRCh38)
Location 17:36890154-36890176 17:36890200-36890222
Sequence CCAGAGCAAGGCCTTATCAGAGC TCCCCATCAAATAGGAAAACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!