ID: 1147232814_1147232819

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1147232814 1147232819
Species Human (GRCh38) Human (GRCh38)
Location 17:39031404-39031426 17:39031445-39031467
Sequence CCAACACCAGGTCAGGATCAAGC CAGCGTTACAGCTCAACCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 4, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!