ID: 1147265953_1147265961

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1147265953 1147265961
Species Human (GRCh38) Human (GRCh38)
Location 17:39234817-39234839 17:39234857-39234879
Sequence CCTGTAGTCCCAGCTATTCAGGA CGTTTTACCCAGAAGGTGGAGGG
Strand - +
Off-target summary {0: 1813, 1: 47694, 2: 166890, 3: 225340, 4: 231835} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!