|
Left Crispr |
Right Crispr |
| Crispr ID |
1147623163 |
1147623171 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:41881687-41881709
|
17:41881737-41881759
|
| Sequence |
CCCAGGTTCAAGCAATTCTCCTG |
TATGCCCCTGCCACCACGTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18481, 1: 76818, 2: 153804, 3: 212009, 4: 151247} |
{0: 1, 1: 0, 2: 24, 3: 979, 4: 12077} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|