ID: 1147623164_1147623171

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147623164 1147623171
Species Human (GRCh38) Human (GRCh38)
Location 17:41881688-41881710 17:41881737-41881759
Sequence CCAGGTTCAAGCAATTCTCCTGC TATGCCCCTGCCACCACGTCTGG
Strand - +
Off-target summary {0: 30902, 1: 81215, 2: 152545, 3: 104312, 4: 56422} {0: 1, 1: 0, 2: 24, 3: 979, 4: 12077}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!