ID: 1147623165_1147623171

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1147623165 1147623171
Species Human (GRCh38) Human (GRCh38)
Location 17:41881706-41881728 17:41881737-41881759
Sequence CCTGCCTCAGCCTCCCGAGTAGC TATGCCCCTGCCACCACGTCTGG
Strand - +
Off-target summary {0: 87862, 1: 235715, 2: 200111, 3: 128617, 4: 141401} {0: 1, 1: 0, 2: 24, 3: 979, 4: 12077}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!