ID: 1147623167_1147623177

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1147623167 1147623177
Species Human (GRCh38) Human (GRCh38)
Location 17:41881710-41881732 17:41881756-41881778
Sequence CCTCAGCCTCCCGAGTAGCTGGC CTGGCTACACAGATCTACCAAGG
Strand - +
Off-target summary {0: 677, 1: 105064, 2: 291600, 3: 225942, 4: 124342} {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!