ID: 1147720441_1147720446

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147720441 1147720446
Species Human (GRCh38) Human (GRCh38)
Location 17:42536470-42536492 17:42536495-42536517
Sequence CCTGGGCGGCGGCGGCGCGGCGC GTGCGGGTGCGCGGCTCCACGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 114, 4: 648} {0: 1, 1: 0, 2: 1, 3: 2, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!