ID: 1147789189_1147789195

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1147789189 1147789195
Species Human (GRCh38) Human (GRCh38)
Location 17:43002600-43002622 17:43002620-43002642
Sequence CCACAAGGATTTGGGCTGTATAG TAGGGGCCCCGGCAGTATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99} {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!