ID: 1148052650_1148052661

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1148052650 1148052661
Species Human (GRCh38) Human (GRCh38)
Location 17:44776725-44776747 17:44776751-44776773
Sequence CCCCACCCCTCTCTCCACAGTGC CCTAACCTGCACAAGCTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 654} {0: 1, 1: 0, 2: 0, 3: 15, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!