ID: 1148105952_1148105961

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1148105952 1148105961
Species Human (GRCh38) Human (GRCh38)
Location 17:45118965-45118987 17:45119008-45119030
Sequence CCGGCCGCTTCAGCAGCCGCCGC CCCCTCTAGACGGTCGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 79, 4: 668} {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!