ID: 1148180583_1148180588

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1148180583 1148180588
Species Human (GRCh38) Human (GRCh38)
Location 17:45601996-45602018 17:45602045-45602067
Sequence CCGATCCTGCCAACTGTACTTTT TCCTGAGACAACTGCACCTGCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 11, 4: 214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!