ID: 1148199213_1148199216

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1148199213 1148199216
Species Human (GRCh38) Human (GRCh38)
Location 17:45738122-45738144 17:45738146-45738168
Sequence CCTTTTGCCTTCTGCTATGAGCA AAGTAGCCTGAGGCCCTCGTCGG
Strand - +
Off-target summary {0: 3, 1: 8, 2: 81, 3: 452, 4: 2333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!