ID: 1148337708_1148337716

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1148337708 1148337716
Species Human (GRCh38) Human (GRCh38)
Location 17:46852245-46852267 17:46852293-46852315
Sequence CCAGGGAGAATGGGGGAAACCTC CGCAGGAAGGAACCGTGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 195} {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!