ID: 1148337715_1148337721

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1148337715 1148337721
Species Human (GRCh38) Human (GRCh38)
Location 17:46852282-46852304 17:46852325-46852347
Sequence CCAGCTGGAGACGCAGGAAGGAA ACCACATCTCAGACCTGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 249} {0: 1, 1: 0, 2: 3, 3: 15, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!