ID: 1148337719_1148337723

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1148337719 1148337723
Species Human (GRCh38) Human (GRCh38)
Location 17:46852305-46852327 17:46852326-46852348
Sequence CCGTGCGCTGGGGAAATGCGACC CCACATCTCAGACCTGGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62} {0: 1, 1: 0, 2: 1, 3: 19, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!