ID: 1148337722_1148337726

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1148337722 1148337726
Species Human (GRCh38) Human (GRCh38)
Location 17:46852326-46852348 17:46852339-46852361
Sequence CCACATCTCAGACCTGGCATGGG CTGGCATGGGGTGATTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 233} {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!