ID: 1148415188_1148415190

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1148415188 1148415190
Species Human (GRCh38) Human (GRCh38)
Location 17:47500849-47500871 17:47500868-47500890
Sequence CCAATTCCTGGATGTTTAAATAC ATACCTATGTTGAGAGATTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!