ID: 1148501780_1148501781

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1148501780 1148501781
Species Human (GRCh38) Human (GRCh38)
Location 17:48097108-48097130 17:48097126-48097148
Sequence CCAGGCGTGGTGGCAGGCGCCTG GCCTGTAATTCCAGCTACTTAGG
Strand - +
Off-target summary {0: 3899, 1: 24362, 2: 59781, 3: 92583, 4: 157353} {0: 2083, 1: 44834, 2: 172258, 3: 271952, 4: 451520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!