|
Left Crispr |
Right Crispr |
Crispr ID |
1148501784 |
1148501788 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:48097136-48097158
|
17:48097159-48097181
|
Sequence |
CCAGCTACTTAGGAGGCCTGAGG |
CAGGAGAATCACTTGAACCGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 43, 2: 293, 3: 1100, 4: 4462} |
{0: 475, 1: 57011, 2: 130808, 3: 165988, 4: 198564} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|