ID: 1148580414_1148580422

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1148580414 1148580422
Species Human (GRCh38) Human (GRCh38)
Location 17:48739420-48739442 17:48739460-48739482
Sequence CCCAGGAGTTCCAGATCAGCCTG CTGTTGAATCCGAAGTTGGATGG
Strand - +
Off-target summary {0: 72, 1: 2020, 2: 17718, 3: 34602, 4: 31305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!