ID: 1148580415_1148580422

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1148580415 1148580422
Species Human (GRCh38) Human (GRCh38)
Location 17:48739421-48739443 17:48739460-48739482
Sequence CCAGGAGTTCCAGATCAGCCTGG CTGTTGAATCCGAAGTTGGATGG
Strand - +
Off-target summary {0: 139, 1: 3788, 2: 36285, 3: 66516, 4: 59721} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!