ID: 1148625277_1148625281

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1148625277 1148625281
Species Human (GRCh38) Human (GRCh38)
Location 17:49064594-49064616 17:49064608-49064630
Sequence CCCACTTCATGACCCATGTGAAT CATGTGAATGCCCCTCAGAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!