ID: 1148645353_1148645355

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1148645353 1148645355
Species Human (GRCh38) Human (GRCh38)
Location 17:49217112-49217134 17:49217134-49217156
Sequence CCGCCACAGTGTTCTAGCGCACA ACACCCTCCTCCTTCCTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85} {0: 1, 1: 1, 2: 3, 3: 61, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!