ID: 1148656461_1148656465

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1148656461 1148656465
Species Human (GRCh38) Human (GRCh38)
Location 17:49287405-49287427 17:49287429-49287451
Sequence CCAGTCTCCTGAGTAGCGGGATT CAGGTGCCCACCACCAGGCCTGG
Strand - +
Off-target summary No data {0: 109, 1: 5518, 2: 23681, 3: 56113, 4: 87699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!