ID: 1148722285_1148722295

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1148722285 1148722295
Species Human (GRCh38) Human (GRCh38)
Location 17:49763019-49763041 17:49763046-49763068
Sequence CCACGTTGGCTGCAATGCCCCGG AACAGCCTTGGTGGGTAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62} {0: 1, 1: 0, 2: 2, 3: 15, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!