ID: 1148755768_1148755773

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1148755768 1148755773
Species Human (GRCh38) Human (GRCh38)
Location 17:49972245-49972267 17:49972258-49972280
Sequence CCCCCGCGGCGGCACCGCAGCGC ACCGCAGCGCGATCCAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144} {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!