ID: 1148755769_1148755776

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1148755769 1148755776
Species Human (GRCh38) Human (GRCh38)
Location 17:49972246-49972268 17:49972268-49972290
Sequence CCCCGCGGCGGCACCGCAGCGCG GATCCAGGAGTGGCCCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103} {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!