ID: 1148755771_1148755775

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1148755771 1148755775
Species Human (GRCh38) Human (GRCh38)
Location 17:49972248-49972270 17:49972267-49972289
Sequence CCGCGGCGGCACCGCAGCGCGAT CGATCCAGGAGTGGCCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30} {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!