ID: 1148780061_1148780065

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1148780061 1148780065
Species Human (GRCh38) Human (GRCh38)
Location 17:50116293-50116315 17:50116338-50116360
Sequence CCTGCTTCATGGGACCTAATGGG AACTATAAAACGTTCCAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 59} {0: 1, 1: 0, 2: 3, 3: 20, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!