ID: 1148835926_1148835931

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1148835926 1148835931
Species Human (GRCh38) Human (GRCh38)
Location 17:50465739-50465761 17:50465761-50465783
Sequence CCAGGGGTTATTGGTAAGGGCGA AGGGTCTCCAGGCTGTCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 83} {0: 1, 1: 0, 2: 2, 3: 4, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!