ID: 1149013292_1149013307

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1149013292 1149013307
Species Human (GRCh38) Human (GRCh38)
Location 17:51880204-51880226 17:51880245-51880267
Sequence CCCTCCTCCCTTTATTCCTCCTG CCGTGTGGTACTGAGTAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 309, 4: 3331} {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!