|
Left Crispr |
Right Crispr |
| Crispr ID |
1149126496 |
1149126499 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:53240955-53240977
|
17:53240975-53240997
|
| Sequence |
CCAGGCAAGGTGGCTCACGCCTG |
CTGTAATTCTAGCACTCAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 356, 1: 19722, 2: 89501, 3: 146736, 4: 178759} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|